Stem-loop sequence hsa-mir-9851

AccessionMI0039502 (change log)
DescriptionHomo sapiens miR-9851 stem-loop
Stem-loop
   --  -    agccu       g           a   u   gu 
5'   gc ggug     ggcgcug caguguuggug cac cac  g
     || ||||     ||||||| ||||||||||| ||| |||   
3'   cg ccau     cuguggc gucacgaccac gug gug  g
   ga  a    ---gu       g           g   -   gu 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 116827488-116827568 [-]
intergenic
Database links

Mature sequence hsa-miR-9851-5p

Accession MIMAT0048639
Sequence

14 - 

cgcuggcaguguuggugacacu

 - 35

Get sequence
Evidence not experimental

Mature sequence hsa-miR-9851-3p

Accession MIMAT0048640
Sequence

49 - 

uggcaccagcacuggcgguguc

 - 70

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).