Stem-loop sequence stu-MIR390

AccessionMI0025988 (change log)
DescriptionSolanum tuberosum miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention stu-MIR390
(7 sentences)

Stem-loop
   --          g       a c   a   caucu 
5'   aagcucagga ggauagc c aug aua     u
     |||||||||| ||||||| | ||| |||      
3'   uuugaguucu ccuaucg g uau uau     a
   au          a       c a   c   caaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138232.1: 264152-264221 [-]
intergenic
Database links

Mature sequence stu-miR390-5p

Accession MIMAT0031343
Sequence

1 - 

aagcucaggagggauagcacc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR390-3p

Accession MIMAT0031344
Sequence

50 - 

cgcuauccaucuugaguuuua

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).