Stem-loop sequence stu-MIR160a

AccessionMI0025955 (change log)
DescriptionSolanum tuberosum miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention stu-MIR160a
(21 sentences)

Stem-loop
   --   c       cu            -   a     c  uaa 
5'   ugc uggcucc  guaugccauuug caa gcuca cg   u
     ||| |||||||  |||||||||||| ||| ||||| ||    
3'   acg accgagg  uaugcgguaagu guu cgggu gc   a
   au   a       ag            u   c     a  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137863.1: 504871-504955 [+]
intergenic
Database links

Mature sequence stu-miR160a-5p

Accession MIMAT0031283
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR160a-3p

Accession MIMAT0031284
Sequence

65 - 

gcguaugaggagccaagcaua

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).