Stem-loop sequence stu-MIR395e

AccessionMI0025943 (change log)
DescriptionSolanum tuberosum miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention stu-MIR395e
(4 sentences)

Stem-loop
   --       ug c       u      uuacu   u 
5'   guucucu  a cgcuuca uagggu     ucg u
     |||||||  | ||||||| ||||||     ||| g
3'   caagggg  u gugaagu gucccg     agu u
   cu       gu u       c      ----u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138865.1: 2236-2304 [+]
intergenic
Database links

Mature sequence stu-miR395e

Accession MIMAT0031266
Sequence

49 - 

cugaaguguuugggggaacuc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).