Stem-loop sequence stu-MIR395d

AccessionMI0025942 (change log)
DescriptionSolanum tuberosum miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention stu-MIR395d
(4 sentences)

Stem-loop
   --       ug c       u     -     uuac 
5'   guucccu  a cacuuca uagga auuaa    u
     |||||||  | ||||||| ||||| |||||    u
3'   caagggg  u gugaagu auccu uaauu    c
   cu       gu u       c     g     uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138105.1: 629597-629668 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR395d
stu-MIR395cJH138105.1: 628404-628475 [+]
stu-MIR395dJH138105.1: 629597-629668 [+]
Database links

Mature sequence stu-miR395d

Accession MIMAT0031265
Sequence

52 - 

cugaaguguuugggggaacuc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).