Stem-loop sequence stu-MIR5303g

AccessionMI0025927 (change log)
DescriptionSolanum tuberosum miR5303g stem-loop
Gene family MIPF0001432; MIR5303
Literature search

3 open access papers mention stu-MIR5303g
(7 sentences)

Stem-loop
   --         c  ca         -----c               aua 
5'   ugcucggac cu  aaagauguu      ucggauccuccaaaa   c
     ||||||||| ||  |||||||||      |||||||||||||||   a
3'   acgagucug ga  uuuuuauag      agccuaggagguuuu   u
   ca         a  ag         augcac               cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137902.1: 155453-155546 [+]
intergenic
Database links

Mature sequence stu-miR5303g

Accession MIMAT0031242
Sequence

71 - 

auauuuuugaagagucugagcaac

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).