Stem-loop sequence hsa-mir-8073

AccessionMI0025909 (change log)
Symbol HGNC:MIR8073
DescriptionHomo sapiens miR-8073 stem-loop
Literature search

2 open access papers mention hsa-mir-8073
(8 sentences)

Stem-loop 
   -  uu     ga       -  agg    -    uca 
5'  ga  ucagu  ccuggca gc   gagc gucg   g
    ||  |||||  ||||||| ||   |||| ||||    
3'  cu  ggucg  ggacugu ug   uuug cagu   u
   c  -u     ag       a  gua    u    uug
Get sequence
Deep sequencing
22 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 110340958-110341029 [+]
intergenic
Database links

Mature sequence hsa-miR-8073

Accession MIMAT0031000
Sequence

11 -  

accuggcagcagggagcgucgu

 - 32

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).