![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-8068 |
|||||
Accession | MI0025904 (change log) | ||||
Symbol | HGNC:MIR8068 | ||||
Description | Homo sapiens miR-8068 stem-loop | ||||
Stem-loop |
- uaacuca cg g 5' ggc uguuuguuguaaggau uugug c ||| |||||||||||||||| ||||| 3' ccg auaaacaacauuccua gacau a a ---uuuc uu a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-8068 |
|
Accession | MIMAT0030995 |
Sequence |
11 - uguuuguuguaaggaucguugu - 32 |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:23612084
"Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes"
Shock. 39:480-487(2013).
|