Stem-loop sequence stu-MIR6149

AccessionMI0025872 (change log)
DescriptionSolanum tuberosum miR6149 stem-loop
Literature search

2 open access papers mention stu-MIR6149
(3 sentences)

Stem-loop
   --     -   c          u       uuuu 
5'   uugca aca accugaaucg caaauau    u
     ||||| ||| |||||||||| |||||||     
3'   aacgu ugu uggacuuagu guuuaua    a
   ca     a   u          u       uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137942.1: 10809-10875 [-]
intergenic
Database links

Mature sequence stu-miR6149-5p

Accession MIMAT0030963
Sequence

1 - 

uugcaacacaccugaaucguc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR6149-3p

Accession MIMAT0031226
Sequence

46 - 

ugauucagguuuguaugcaaac

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).