Stem-loop sequence stu-MIR8011b

AccessionMI0025859 (change log)
DescriptionSolanum tuberosum miR8011b stem-loop
Literature search

1 open access papers mention stu-MIR8011b
(1 sentences)

Stem-loop
   --a  ca            a     a  a  c    agu 
5'    cu  uuuuugucucac aaaaa ua ac caaa   g
      ||  |||||||||||| ||||| || || ||||   u
3'    ga  aaaaacagagug uuuuu au ug guuu   a
   ucc  ag            c     c  c  a    aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138056.1: 287593-287671 [+]
intergenic
Database links

Mature sequence stu-miR8011b-5p

Accession MIMAT0031218
Sequence

1 - 

acucauuuuugucucacaaaaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8011b-3p

Accession MIMAT0030950
Sequence

58 - 

uucgugagacaaaaagaagccu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).