Stem-loop sequence stu-MIR8038a

AccessionMI0025857 (change log)
DescriptionSolanum tuberosum miR8038a stem-loop
Gene family MIPF0001737; MIR8038
Literature search

2 open access papers mention stu-MIR8038a
(4 sentences)

Stem-loop
   --  uu              u              acuucaac       g 
5'   cc  gugaguaaguugaa cucaugcuuguuaa        acguguu c
     ||  |||||||||||||| ||||||||||||||        |||||||  
3'   gg  cacucguucaacuu gaguacgaacaauu        ugcguaa a
   ga  uu              -              --caaccc       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138051.1: 882831-882929 [+]
intergenic
Database links

Mature sequence stu-miR8038a-5p

Accession MIMAT0030948
Sequence

1 - 

ccuugugaguaaguugaaucuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8038a-3p

Accession MIMAT0031216
Sequence

79 - 

guucaacuugcucacuuggag

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).