![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence stu-MIR8032c |
|||||
Accession | MI0025847 (change log) | ||||
Description | Solanum tuberosum miR8032c stem-loop | ||||
Gene family | MIPF0001653; MIR8032 | ||||
Literature search |
1 open access papers mention stu-MIR8032c | ||||
Stem-loop |
-- g - c ag u 5' uggucg cau gacuc cg g u |||||| ||| ||||| || | 3' auuagc gug cugag gu c u gg - u u aa u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence stu-miR8032c |
|
Accession | MIMAT0030938 |
Sequence |
1 - uggucggcaugacucccgaggu - 22 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:23437348
"Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing"
PLoS One. 8:e57233(2013).
|