Stem-loop sequence stu-MIR8032c

AccessionMI0025847 (change log)
DescriptionSolanum tuberosum miR8032c stem-loop
Gene family MIPF0001653; MIR8032
Literature search

1 open access papers mention stu-MIR8032c
(2 sentences)

Stem-loop
   --      g   -     c  ag u 
5'   uggucg cau gacuc cg  g u
     |||||| ||| ||||| ||  |  
3'   auuagc gug cugag gu  c u
   gg      -   u     u  aa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138081.1: 745494-745541 [+]
intergenic
Database links

Mature sequence stu-miR8032c

Accession MIMAT0030938
Sequence

1 - 

uggucggcaugacucccgaggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).