Stem-loop sequence stu-MIR1886i

AccessionMI0025834 (change log)
DescriptionSolanum tuberosum miR1886i stem-loop
Gene family MIPF0001647; MIR1886
Literature search

1 open access papers mention stu-MIR1886i
(1 sentences)

Stem-loop
   --                  uu    a 
5'   augagaugaaauuagcgu  ggau u
     ||||||||||||||||||  |||| g
3'   uacucuacuuuaguugca  uuua c
   ag                  -u    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138128.1: 40008-40061 [-]
intergenic
Database links

Mature sequence stu-miR1886i-5p

Accession MIMAT0030925
Sequence

1 - 

augagaugaaauuagcguuuggau

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR1886i-3p

Accession MIMAT0031202
Sequence

32 - 

uuuacguugauuucaucucauga

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).