Stem-loop sequence stu-MIR8016

AccessionMI0025822 (change log)
DescriptionSolanum tuberosum miR8016 stem-loop
Literature search

1 open access papers mention stu-MIR8016
(1 sentences)

Stem-loop
   --     u      u             ua  uua 
5'   caugg cuuuuc uucaaaaauauau  ua   g
     ||||| |||||| |||||||||||||  ||    
3'   guacc ggaagg aaguuuuuauaua  gu   g
   gu     c      u             uc  uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137804.1: 952075-952144 [+]
intergenic
Database links

Mature sequence stu-miR8016

Accession MIMAT0030913
Sequence

47 - 

auuuuugaauggaaggcccaugug

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).