Stem-loop sequence stu-MIR5303f

AccessionMI0025813 (change log)
DescriptionSolanum tuberosum miR5303f stem-loop
Gene family MIPF0001432; MIR5303
Literature search

3 open access papers mention stu-MIR5303f
(7 sentences)

Stem-loop
   --a   -                    
5'    cgu ucggauucuccaaaaguaa 
      ||| |||||||||||||||||| u
3'    gca agucuaagagguuuuuaug 
   ugg   c                    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138336.1: 156713-156762 [-]
intergenic
Database links

Mature sequence stu-miR5303f

Accession MIMAT0030904
Sequence

27 - 

auuuuuggagaaucugacacgggu

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).