Stem-loop sequence stu-MIR7997b

AccessionMI0025795 (change log)
DescriptionSolanum tuberosum miR7997b stem-loop
Gene family MIPF0001870; MIR7997
Literature search

1 open access papers mention stu-MIR7997b
(6 sentences)

Stem-loop
   -----a  c    c  a       ---aaa      gugg  g    cu              ag 
5'       ug ugcu gg cucuuca      auguca    gu cgug  ggauucuccaaagg  u
         || |||| || |||||||      ||||||    || ||||  ||||||||||||||   
3'       ac acga cc gagaagu      uacagu    ug guac  uuuaagagguuuuu  g
   gauuca  -    -  -       gaaaac      ---a  g    ag              au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137797.1: 3479983-3480100 [+]
intergenic
Database links

Mature sequence stu-miR7997b

Accession MIMAT0030886
Sequence

1 - 

augcugcucggacucuucaaa

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).