Stem-loop sequence stu-MIR7996c

AccessionMI0025793 (change log)
DescriptionSolanum tuberosum miR7996c stem-loop
Gene family MIPF0001691; MIR7996
Literature search

1 open access papers mention stu-MIR7996c
(1 sentences)

Stem-loop
   --          u         g   --     c        ---     g         auuu   g   c        u  -    ag         u 
5'   augugguaca augaaauuu aaa  uuaau aauuuuuu   aguuu uuuuuauau    uaa uug uaauuauu gu auuu  aguauguuu a
     |||||||||| ||||||||| |||  ||||| ||||||||   ||||| |||||||||    ||| ||| |||||||| || ||||  ||||||||| c
3'   uacacuaugu uacuuuaaa uuu  aguua uuaaaaaa   ucaaa aaaaauaua    auu aac auuaauaa ca uaaa  uuauauaaa g
   aa          u         g   uc     c        uau     a         ----   g   a        -  c    ga         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138313.1: 61352-61541 [+]
intergenic
Database links

Mature sequence stu-miR7996c

Accession MIMAT0030884
Sequence

1 - 

augugguacauaugaaauuugaaa

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).