![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-7156 |
|||||
Accession | MI0023616 (change log) | ||||
Symbol | HGNC:MIR7156 | ||||
Description | Homo sapiens miR-7156 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-7156 | ||||
Stem-loop |
--uu a c cag g 5' guucuc aa uggcugu agu ugca |||||| || ||||||| ||| ||| u 3' caaggg uu accgacg ucg acgg uggu g c --- g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-7156-5p |
|
Accession | MIMAT0028222 |
Sequence |
1 - uuguucucaaacuggcugucaga - 23 |
Deep sequencing | 40 reads, 13 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-7156-3p |
|
Accession | MIMAT0028223 |
Sequence |
38 - cugcagccacuuggggaacuggu - 60 |
Deep sequencing | 3 reads, 1 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|