Stem-loop sequence hsa-mir-6860

AccessionMI0022707 (change log)
Symbol HGNC:MIR6860
DescriptionHomo sapiens miR-6860 stem-loop
Stem-loop 
   ---------guua   a   ggg       ag   g 
5'              agc uug   aguuugg  ucg u
                ||| |||   |||||||  ||| g
3'              ucg gac   ucaaacc  ggu g
   ugagugaguggug   g   ggg       ga   g
Get sequence
Deep sequencing
116 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 67045643-67045708 [+]
sense
OTTHUMT00000393156 ; ADRBK1-002; intron 1
OTTHUMT00000393153 ; ADRBK1-001; intron 2
OTTHUMT00000393154 ; ADRBK1-011; intron 2
OTTHUMT00000393155 ; ADRBK1-010; intron 2
ENST00000416281 ; ADRBK1-002; intron 1
ENST00000308595 ; ADRBK1-001; intron 2
ENST00000526285 ; ADRBK1-011; intron 2
ENST00000530291 ; ADRBK1-010; intron 2
Database links

Mature sequence hsa-miR-6860

Accession MIMAT0027622
Sequence

41 -  

acugggcagggcuguggugagu

 - 62

Get sequence
Deep sequencing112 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).