Stem-loop sequence hsa-mir-6855

AccessionMI0022701 (change log)
Symbol HGNC:MIR6855
DescriptionHomo sapiens miR-6855 stem-loop
Literature search

1 open access papers mention hsa-mir-6855
(3 sentences)

Stem-loop 
   g   cu       ug    g   -aca     aga 
5'  cug  ugggguu  gggu cag    uugcc   g
    |||  |||||||  |||| |||    |||||    
3'  gac  accccaa  ucca guc    gacgg   g
   -   --       cu    -   agac     gua
Get sequence
Deep sequencing
122 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 129869605-129869671 [+]
sense
OTTHUMT00000054134 ; RALGPS1-002; intron 7
OTTHUMT00000054133 ; RALGPS1-001; intron 8
OTTHUMT00000054138 ; RALGPS1-006; intron 8
OTTHUMT00000054139 ; RALGPS1-007; intron 8
ENST00000373434 ; RALGPS1-002; intron 7
ENST00000259351 ; RALGPS1-001; intron 8
ENST00000394022 ; RALGPS1-006; intron 8
ENST00000373436 ; RALGPS1-007; intron 8
ENST00000424082 ; RALGPS1-201; intron 8
antisense
OTTHUMT00000054130 ; ANGPTL2-002; intron 1
OTTHUMT00000054132 ; ANGPTL2-004; intron 1
OTTHUMT00000054131 ; ANGPTL2-003; intron 1
OTTHUMT00000054129 ; ANGPTL2-001; intron 2
ENST00000373417 ; ANGPTL2-002; intron 1
ENST00000491991 ; ANGPTL2-004; intron 1
ENST00000470194 ; ANGPTL2-003; intron 1
ENST00000373425 ; ANGPTL2-001; intron 2
Database links

Mature sequence hsa-miR-6855-5p

Accession MIMAT0027610
Sequence

6 -  

uugggguuuggggugcagacauugc

 - 30

Get sequence
Deep sequencing52 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6855-3p

Accession MIMAT0027611
Sequence

46 -  

agacugaccuucaaccccacag

 - 67

Get sequence
Deep sequencing68 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).