Stem-loop sequence hsa-mir-6838

AccessionMI0022684 (change log)
Symbol HGNC:MIR6838
DescriptionHomo sapiens miR-6838 stem-loop
Literature search

1 open access papers mention hsa-mir-6838
(1 sentences)

Stem-loop 
   cagggaa       u    a    -  uag 
5'        gcagcag ggca gacu cc   g
          ||||||| |||| |||| ||    
3'        cguuguc ucgu cuga gg   u
   -----ga       u    c    a  cac
Get sequence
Deep sequencing
85 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 44073378-44073433 [-]
sense
OTTHUMT00000339613 ; AC004985.13-003; intron 2
OTTHUMT00000339612 ; AC004985.13-002; intron 2
OTTHUMT00000339611 ; AC004985.13-001; intron 8
ENST00000446874 ; RASA4CP-003; intron 2
ENST00000425524 ; RASA4CP-002; intron 2
ENST00000545716 ; RASA4CP-201; intron 3
ENST00000424092 ; RASA4CP-001; intron 8
Database links

Mature sequence hsa-miR-6838-5p

Accession MIMAT0027578
Sequence

6 -  

aagcagcaguggcaagacuccu

 - 27

Get sequence
Deep sequencing42 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6838-3p

Accession MIMAT0027579
Sequence

37 -  

aaguccugcuucuguugcag

 - 56

Get sequence
Deep sequencing43 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).