Stem-loop sequence hsa-mir-6515

AccessionMI0022227 (change log)
Symbol HGNC:MIR6515
DescriptionHomo sapiens miR-6515 stem-loop
Literature search

2 open access papers mention hsa-mir-6515
(6 sentences)

Stem-loop
   cau   a     -ug     c   u   c 
5'    ugg gggug   gaaga auc ggg c
      ||| |||||   ||||| ||| |||  
3'    acc cccau   cuucu uag cuc a
   --g   c     cua     c   u   a 
Get sequence
Deep sequencing
633 reads, 4.03 reads per million, 124 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 12940484-12940540 [+]
sense
OTTHUMT00000451541 ; CTD-2265O21.3-001; intron 2
ENST00000588469 ; CTD-2265O21.3-001; intron 2
antisense
OTTHUMT00000451500 ; HOOK2-024; intron 1
OTTHUMT00000451534 ; RTBDN-004; intron 2
OTTHUMT00000451513 ; RTBDN-003; intron 2
OTTHUMT00000451535 ; RTBDN-010; intron 2
OTTHUMT00000451536 ; RTBDN-009; intron 2
OTTHUMT00000451729 ; RTBDN-011; intron 2
OTTHUMT00000451537 ; RTBDN-005; intron 2
OTTHUMT00000451538 ; RTBDN-008; intron 2
OTTHUMT00000451730 ; RTBDN-012; intron 2
OTTHUMT00000451539 ; RTBDN-007; intron 2
OTTHUMT00000451511 ; RTBDN-001; intron 3
OTTHUMT00000451512 ; RTBDN-002; intron 3
OTTHUMT00000451540 ; RTBDN-006; intron 3
ENST00000589765 ; HOOK2-024; intron 1
ENST00000592204 ; RTBDN-004; intron 2
ENST00000458671 ; RTBDN-003; intron 2
ENST00000586969 ; RTBDN-010; intron 2
ENST00000589681 ; RTBDN-009; intron 2
ENST00000589808 ; RTBDN-011; intron 2
ENST00000590404 ; RTBDN-005; intron 2
ENST00000585384 ; RTBDN-008; intron 2
ENST00000589567 ; RTBDN-012; intron 2
ENST00000591512 ; RTBDN-007; intron 2
ENST00000589272 ; RTBDN-001; intron 3
ENST00000322912 ; RTBDN-002; intron 3
ENST00000587549 ; RTBDN-006; intron 3
ENST00000393233 ; RTBDN-201; intron 3
Database links

Mature sequence hsa-miR-6515-5p

Accession MIMAT0025486
Sequence

3 - 

uuggaggguguggaagacauc

 - 23

Get sequence
Deep sequencing354 reads, 97 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-6515-3p

Accession MIMAT0025487
Sequence

38 - 

ucucuucaucuaccccccag

 - 57

Get sequence
Deep sequencing67 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).
2
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).