Stem-loop sequence tgu-mir-30e

AccessionMI0022188 (change log)
DescriptionTaeniopygia guttata miR-30e stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   -uu      ccu          u  a       a    a 
5'    uuaguu   guaaacaucc ac cucagcu uuau a
      ||||||   |||||||||| || ||||||| |||| g
3'    agucaa   cauuuguggg ug gggucgg ggug u
   uuc      cuu          u  g       -    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 149534042-149534120 [-]
sense
ENSTGUT00000018577 ; tgu-mir-30e-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-30e
tgu-mir-2991chr2: 149540758-149540826 [-]
tgu-mir-30dchr2: 149540698-149540769 [-]
tgu-mir-30echr2: 149534042-149534120 [-]
Database links

Mature sequence tgu-miR-30e

Accession MIMAT0025411
Sequence

11 - 

uguaaacauccuacacucagcu

 - 32

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).