![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-196 |
|||||
Accession | MI0022171 (change log) | ||||
Description | Taeniopygia guttata miR-196 stem-loop | ||||
Gene family | MIPF0000031; mir-196 | ||||
Stem-loop |
---------- u a u cucc 5' gguu agguaguuuc uguugu gggg a |||| |||||||||| |||||| |||| c 3' uuaa uccgucaaag acgaca cucu c guugacuuca u c u cuuu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-196 |
|
Accession | MIMAT0025394 |
Sequence |
5 - uagguaguuucauguuguug - 24 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21210939
"microRNA complements in deuterostomes: origin and evolution of microRNAs"
Evol Dev. 13:15-27(2011).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|