![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR6246 |
|||||
Accession | MI0021594 (change log) | ||||
Description | Oryza sativa miR6246 stem-loop | ||||
Literature search |
1 open access papers mention osa-MIR6246 | ||||
Stem-loop |
- - - u g a u 5' aacccucaga uuggg ga uuccu ccggagg agcuuu u |||||||||| ||||| || ||||| ||||||| |||||| g 3' uugggagucu gaccu cu aagga gguuucc ucgagg g u u u c g g a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR6246 |
|
Accession | MIMAT0024867 |
Sequence |
11 - uuggggauuuccugccggaggaa - 33 |
Deep sequencing | 5 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22585409
"Novel miRNAs in the control of arsenite levels in rice"
Funct Integr Genomics. 12:649-658(2012).
|