Stem-loop sequence osa-MIR6246

Accession

MI0021594 (change log)

Description

Oryza sativa miR6246 stem-loop

Literature search

1 open access papers mention osa-MIR6246
(1 sentences)

Stem-loop

   -          -     -  u     g       a      u 
5'  aacccucaga uuggg ga uuccu ccggagg agcuuu u
    |||||||||| ||||| || ||||| ||||||| |||||| g
3'  uugggagucu gaccu cu aagga gguuucc ucgagg g
   u          u     u  c     g       g      a 

Deep sequencing

7 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr3: 1625438-1625521 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021594

Mature sequence osa-miR6246

• Accession: MIMAT0024867
• Sequence: 11 - uuggggauuuccugccggaggaa - 33
• Deep sequencing: 5 reads, 2 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).