Stem-loop sequence hsa-mir-6068

AccessionMI0020345 (change log)
Symbol HGNC:MIR6068
DescriptionHomo sapiens miR-6068 stem-loop
Literature search

1 open access papers mention hsa-mir-6068
(1 sentences)

Stem-loop 
   ccug       c  g   ug  uu     u 
5'     cgagucu cg cgg  gc  guggc g
       ||||||| || |||  ||  ||||| a
3'     gcucgga gc guc  cg  cacug g
   -ccg       c  g   gu  --     u
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 63326925-63326984 [-]
antisense
OTTHUMT00000025332 ; ATG4C-001; intron 10
OTTHUMT00000025333 ; ATG4C-002; intron 10
ENST00000317868 ; ATG4C-001; intron 10
ENST00000371120 ; ATG4C-002; intron 10
Database links

Mature sequence hsa-miR-6068

Accession MIMAT0023693
Sequence

1 -  

ccugcgagucuccggcggugg

 - 21

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).