Stem-loop sequence hsa-mir-5692c-2

AccessionMI0019289 (change log)
Symbol HGNC:MIR5692C2
DescriptionHomo sapiens miR-5692c-2 stem-loop
Gene family MIPF0001351; mir-5692
Stem-loop
   u         a            ggag     uu    u 
5'  guguacacc acugugauauua    uccua  uauu u
    ||||||||| ||||||||||||    |||||  |||| u
3'  cacaugugg ugacacuauaau    aggau  auag a
   a         a            ---a     -u    g 
Get sequence
Deep sequencing
46 reads, 3.45 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 97964405-97964481 [-]
sense
OTTHUMT00000334684 ; BAIAP2L1-004; intron 1
OTTHUMT00000334681 ; BAIAP2L1-001; intron 3
OTTHUMT00000334682 ; BAIAP2L1-002; intron 3
ENST00000473569 ; BAIAP2L1-004; intron 1
ENST00000005260 ; BAIAP2L1-001; intron 3
ENST00000462558 ; BAIAP2L1-002; intron 3
Clustered miRNAs
< 10kb from hsa-mir-5692c-2
hsa-mir-5692c-2chr7: 97964405-97964481 [-]
hsa-mir-5692a-1chr7: 97963658-97963726 [+]
Database links

Mature sequence hsa-miR-5692c

Accession MIMAT0022476
Sequence

53 - 

aauaauaucacaguagguguac

 - 74

Get sequence
Deep sequencing46 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).