Stem-loop sequence hsa-mir-5587

AccessionMI0019144 (change log)
Symbol HGNC:MIR5587
DescriptionHomo sapiens miR-5587 stem-loop
Stem-loop 
   -        -  --     a      c 
5'  auggucac cu  ccggg cucagc c
    |||||||| ||  ||||| |||||| u
3'  uacuagug ga  ggccc gagucg g
   c        u  cg     c      u
Get sequence
Deep sequencing
96 reads, 3.7 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 535316-535368 [+]
sense
OTTHUMT00000139678 ; RAB11FIP3-004; intron 1
OTTHUMT00000139676 ; RAB11FIP3-002; intron 2
OTTHUMT00000313690 ; RAB11FIP3-008; intron 2
OTTHUMT00000313691 ; RAB11FIP3-009; intron 2
OTTHUMT00000109066 ; RAB11FIP3-001; intron 4
OTTHUMT00000317787 ; RAB11FIP3-010; intron 4
ENST00000412256 ; RAB11FIP3-004; intron 1
ENST00000452814 ; RAB11FIP3-002; intron 2
ENST00000483002 ; RAB11FIP3-008; intron 2
ENST00000449879 ; RAB11FIP3-009; intron 2
ENST00000450428 ; RAB11FIP3-201; intron 2
ENST00000262305 ; RAB11FIP3-001; intron 4
ENST00000434585 ; RAB11FIP3-010; intron 4
ENST00000457159 ; RAB11FIP3-202; intron 4
Clustered miRNAs
< 10kb from hsa-mir-5587
hsa-mir-5587chr16: 535316-535368 [+]
hsa-mir-3176chr16: 543277-543366 [+]
Database links

Mature sequence hsa-miR-5587-5p

Accession MIMAT0022289
Sequence

1 -  

auggucaccuccgggacu

 - 18

Get sequence
Deep sequencing47 reads, 22 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5587-3p

Accession MIMAT0022290
Sequence

33 -  

gccccgggcagugugaucauc

 - 53

Get sequence
Deep sequencing47 reads, 13 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).