Stem-loop sequence mtr-MIR5559

AccessionMI0019086 (change log)
DescriptionMedicago truncatula miR5559 stem-loop
Gene family MIPF0001606; MIR5559
Stem-loop
   uauu                  u        a      aucaaucaaccacauugaagcuucauguau 
5'     uccuuuuacuuggugaau guuggauc uucugu                              a
       |||||||||||||||||| |||||||| ||||||                               
3'     aggaaaaugaaccacuua uaaucuag aagaca                              a
   gcau                  u        c      caaagaagaaacuuauagcaacuagaacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 1058333-1058470 [+]
intergenic
Database links

Mature sequence mtr-miR5559-5p

Accession MIMAT0022221
Previous IDsmtr-miR5559
Sequence

11 - 

uacuuggugaauuguuggauc

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR5559-3p

Accession MIMAT0022222
Previous IDsmtr-miR5559*
Sequence

110 - 

ucuaauuauucaccaaguaaa

 - 130

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).