Stem-loop sequence osa-MIR5517

AccessionMI0019036 (change log)
DescriptionOryza sativa miR5517 stem-loop
Literature search

2 open access papers mention osa-MIR5517
(7 sentences)

Stem-loop
   caaaucaauu     ca         -   a aaccc    ca   g      
5'           ugcau  cggcgcaua ugu g     cguu  guu acuac 
             |||||  ||||||||| ||| |     ||||  ||| |||| a
3'           augua  gccgugugu gcg c     gcaa  cga ugaua 
   accgacaugc     ac         u   a -guaa    ac   a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 24618621-24618723 [-]
intergenic
Database links

Mature sequence osa-miR5517

Accession MIMAT0022151
Sequence

11 - 

ugcaucacggcgcauauguag

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1