Stem-loop sequence osa-MIR5514

AccessionMI0019033 (change log)
DescriptionOryza sativa miR5514 stem-loop
Literature search

2 open access papers mention osa-MIR5514
(2 sentences)

Stem-loop
   -   ga   ---cu         uuu    -      -c      ucugcca  a 
5'  uug  cag     ucccagagc   ggcc gucgcu  cggucu       ug c
    |||  |||     |||||||||   |||| ||||||  ||||||       ||  
3'  gac  guu     agggucuug   ccgg cagcgg  gccagg       ac a
   a   aa   caagu         -uu    u      cc      -uuucua  u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 22840161-22840264 [+]
intergenic
Database links

Mature sequence osa-miR5514

Accession MIMAT0022148
Sequence

11 - 

ucccagagcuuuggccgucgc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1