Stem-loop sequence osa-MIR5492

AccessionMI0019010 (change log)
DescriptionOryza sativa miR5492 stem-loop
Literature search

1 open access papers mention osa-MIR5492
(4 sentences)

Stem-loop
   acaaug    a  -       ua    -ug        ---        aaaucauucuggugauuggauuuaaucagugucuucuug 
5'       aggg ga aggagaa  gaua   guugaguu   aauuauag                                       g
         |||| || |||||||  ||||   ||||||||   ||||||||                                        
3'       uccc cu uccucuu  uugu   uaacucag   uugguguu                                       g
   uacuua    a  c       ug    caa        auu        aauaaucuuuuuuuucacauugaaaauaaucaacgugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 16973816-16973988 [+]
intergenic
Database links

Mature sequence osa-miR5492

Accession MIMAT0022125
Sequence

11 - 

agaaggagaauagauaugguu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1