![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR171h |
||||||
Accession | MI0018372 (change log) | |||||
Description | Medicago truncatula miR171h stem-loop | |||||
Gene family | MIPF0000104; MIR171_2 | |||||
Literature search |
![]()
9 open access papers mention mtr-MIR171h | |||||
Stem-loop |
aa ag a u u a uaaauaa au a 5' gu ac ggagugguguug uuc gcuc ucuuau uga gaaug a || || |||||||||||| ||| |||| |||||| ||| ||||| u 3' ca ug ccucacuauaac aag cgag agaaua auu uuuac g uc ca a u c c ----uuc cg a |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mtr-miR171h |
|
Accession | MIMAT0021269 |
Sequence |
79 - cgagccgaaucaauaucacuc - 99 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|