Stem-loop sequence mtr-MIR2111l

AccessionMI0018359 (change log)
DescriptionMedicago truncatula miR2111l stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111l
(8 sentences)

Stem-loop 
        -    a        c   ca     u      -    au 
5' auaag aaau gguaaucu cau  ugagg uuagag uaau  u
   ||||| |||| |||||||| |||  ||||| |||||| ||||   
3' uauuc uuua cuauuaga gua  guucc aaucuc auug  u
        c    -        c   ag     u      c    au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111l

Accession MIMAT0021255
Sequence

57 -  

auccuuggaaugcagauuauc

 - 77

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).