![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR2111l |
|
Accession | MI0018359 (change log) |
Description | Medicago truncatula miR2111l stem-loop |
Gene family | MIPF0000754; MIR2111 |
Literature search |
2 open access papers mention mtr-MIR2111l |
Stem-loop |
- a c ca u - au 5' auaag aaau gguaaucu cau ugagg uuagag uaau u ||||| |||| |||||||| ||| ||||| |||||| |||| 3' uauuc uuua cuauuaga gua guucc aaucuc auug u c - c ag u c au |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence mtr-miR2111l |
|
Accession | MIMAT0021255 |
Sequence |
57 - auccuuggaaugcagauuauc - 77 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|