![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR4414b |
|
Accession | MI0018316 (change log) |
Description | Medicago truncatula miR4414b stem-loop |
Gene family | MIPF0000010; MIR159 |
Literature search |
1 open access papers mention mtr-MIR4414b |
Stem-loop |
-guuu -- g ac u aa agaaga a 5' ugaa uuagcu cug ucauucau ca cacaaua agcaug u |||| |||||| ||| |||||||| || ||||||| |||||| g 3' acuu aaucga ggc aguaagug gu guguuau ucguau a uuucu ua g gu u aa -----a a |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence mtr-miR4414b |
|
Accession | MIMAT0021211 |
Sequence |
76 - ugugaaugaugcgggagcuaa - 96 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|