Stem-loop sequence mtr-MIR4414b

AccessionMI0018316 (change log)
DescriptionMedicago truncatula miR4414b stem-loop
Gene family MIPF0000010; MIR159
Literature search

1 open access papers mention mtr-MIR4414b
(1 sentences)

Stem-loop 
   -guuu    --      g   ac        u  aa       agaaga      a 
5'      ugaa  uuagcu cug  ucauucau ca  cacaaua      agcaug u
        ||||  |||||| |||  |||||||| ||  |||||||      |||||| g
3'      acuu  aaucga ggc  aguaagug gu  guguuau      ucguau a
   uuucu    ua      g   gu        u  aa       -----a      a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR4414b

Accession MIMAT0021211
Sequence

76 -  

ugugaaugaugcgggagcuaa

 - 96

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).