![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR4414a |
|||||
Accession | MI0018312 (change log) | ||||
Description | Medicago truncatula miR4414a stem-loop | ||||
Gene family | MIPF0001299; MIR4414 | ||||
Literature search |
2 open access papers mention mtr-MIR4414a | ||||
Stem-loop |
-- ag cu g ac u au u ----- g 5' ggcug a cagcu cug ucguugg uca agc caca acau c ||||| | ||||| ||| ||||||| ||| ||| |||| |||| a 3' cugac u gucga ggc agcaacc agu ucg gugu ugug u ug cu ac g gu u cu u gcaac a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mtr-miR4414a-5p |
|
Accession | MIMAT0021206 |
Previous IDs | mtr-miR4414a |
Sequence |
12 - agcugcugacucguugguuca - 32 |
Evidence | experimental; Illumina [1-3] |
Mature sequence mtr-miR4414a-3p |
|
Accession | MIMAT0021207 |
Previous IDs | mtr-miR4414a* |
Sequence |
73 - auccaacgaugcgggagcugc - 93 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:21762498
"Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing"
BMC Genomics. 12:367(2011).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|