Stem-loop sequence mtr-MIR4414a

AccessionMI0018312 (change log)
DescriptionMedicago truncatula miR4414a stem-loop
Gene family MIPF0001299; MIR4414
Literature search

2 open access papers mention mtr-MIR4414a
(2 sentences)

Stem-loop 
   --     ag cu     g   ac       u   au   u    -----    g 
5'   ggcug  a  cagcu cug  ucguugg uca  agc caca     acau c
     |||||  |  ||||| |||  ||||||| |||  ||| ||||     |||| a
3'   cugac  u  gucga ggc  agcaacc agu  ucg gugu     ugug u
   ug     cu ac     g   gu       u   cu   u    gcaac    a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 31864157-31864260 [-]
intergenic
Database links

Mature sequence mtr-miR4414a-5p

Accession MIMAT0021206
Previous IDsmtr-miR4414a
Sequence

12 -  

agcugcugacucguugguuca

 - 32

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence mtr-miR4414a-3p

Accession MIMAT0021207
Previous IDsmtr-miR4414a*
Sequence

73 -  

auccaacgaugcgggagcugc

 - 93

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:21762498 "Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing" Wang T, Chen L, Zhao M, Tian Q, Zhang WH BMC Genomics. 12:367(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).