Stem-loop sequence bdi-MIR169f

AccessionMI0018160 (change log)
DescriptionBrachypodium distachyon miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169f
(29 sentences)

Stem-loop
   -    c     g  c a    c        a  c          gacuugccggccggcuggccggcaaugucgc 
5'  gggc augca ga g ggca agagcagg ug agccaaggau                               c
    |||| ||||| || | |||| |||||||| || ||||||||||                               g
3'  cccg ugugu cu c ccgu ucucguuc ac ucgguuccug                               c
   u    u     a  a -    c        c  a          uuugaacggcccguucguaguacagugcggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 16738806-16738956 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR169f
bdi-MIR169f3: 16738806-16738956 [+]
bdi-MIR7748b3: 16741357-16741575 [-]
Database links

Mature sequence bdi-miR169f

Accession MIMAT0020736
Sequence

33 - 

cagccaaggaugacuugccgg

 - 53

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).