Stem-loop sequence bdi-MIR5179

AccessionMI0018151 (change log)
DescriptionBrachypodium distachyon miR5179 stem-loop
Gene family MIPF0001641; MIR5179
Stem-loop
   -guugcuc   caucccu     --     -    -                 a aguu     uga  c       c   c uu       auauaucu     aguucgaccaauggaucuaaggaa 
5'         cuu       agauc  ucuca uguu uugcucaagaccgcgca c    ccaua   ca cgcaucg ugu c  gccuauc        cauga                        g
           |||       |||||  ||||| |||| ||||||||||||||||| |    |||||   || ||||||| ||| |  |||||||        |||||                         
3'         gaa       ucuag  agagu gcaa aacgaguucuggcgugu g    gguau   gu gcguagc gca g  uggauag        guacu                        a
   uauuuaua   cuuauuc     gc     u    u                 c gacu     -ug  c       u   a uc       ---gaaau     agguguacgaacguuagaaaaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 9493263-9493513 [-]
intergenic
Database links

Mature sequence bdi-miR5179

Accession MIMAT0020727
Sequence

30 - 

uuuugcucaagaccgcgcaac

 - 50

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).