Stem-loop sequence bdi-MIR5170

AccessionMI0018139 (change log)
DescriptionBrachypodium distachyon miR5170 stem-loop
Stem-loop
   -----------------------------------------------guauagucaauguauuuuggaaaucgagacuuacgaucauugaacuugucgaaacgucccacguaugaucaccgacgca               gguugcca      ca  -uu                    ---     c  uu    u     -----au    uc a 
5'                                                                                                                               gugucgccugugcua        gcucag  cg   uuuugcaauuuguccccuga   auaau cc  gcgg gggac       gcug  c c
                                                                                                                                 |||||||||||||||        ||||||  ||   ||||||||||||||||||||   ||||| ||  |||| |||||       ||||  |  
3'                                                                                                                               cgcaguggauacgau        ugaguc  gc   aaaacguuaaacgggggacu   uauua gg  ugcu cccug       cgac  g g
   uaggugacuucaagugacuugaaccaaaguuaagaguuaaaucagugacauaaaauuuuuaguuuugaaugccagugaguugaacuacuuuauaugguguauaacaugacauaaagauggcauaca               --------      uc  cuu                    ucu     u  --    -     aauuaac    cc u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 56853936-56854310 [-]
intergenic
Database links

Mature sequence bdi-miR5170

Accession MIMAT0020714
Sequence

287 - 

ucaucaaguugagugaccgua

 - 307

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).