Stem-loop sequence bdi-MIR319a

AccessionMI0018137 (change log)
Previous IDsbdi-MIR319
DescriptionBrachypodium distachyon miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention bdi-MIR319a
(3 sentences)

Stem-loop
   uuau  c     ga         --auucauu          uu    u     cc     g   u  cg    uu      g  g   ac      a    aa             acuggauaugcagacuaauccaag 
5'     ag agaag  ggaggaggu         ugagggagcu  cuuc gucca  caugg agg ag  ggga  gaacga cu ccg  ucauuc cucg  cacacaguggaua                        g
       || |||||  |||||||||         ||||||||||  |||| |||||  ||||| ||| ||  ||||  |||||| || |||  |||||| ||||  |||||||||||||                         
3'     uc ucuuc  ccucuuuca         acucccucga  gaag caggu  guacc ucc uc  uucu  cuuguu ga ggc  aguaag gagu  gugugucaucuau                        c
   uagu  c     uc         cuacucucc          gg    u     uc     -   -  cu    cu      a  g   ga      c    aa             aauaaggugugaucaucuauaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 31253293-31253572 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR319a
bdi-MIR319a4: 31253293-31253572 [+]
bdi-MIR77424: 31253366-31253495 [-]
Database links

Mature sequence bdi-miR319a

Accession MIMAT0020712
Previous IDsbdi-miR319
Sequence

31 - 

ugagggagcuuucuucugucc

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).