Stem-loop sequence bdi-MIR5164

AccessionMI0018131 (change log)
DescriptionBrachypodium distachyon miR5164 stem-loop
Gene family MIPF0000382; MIR1122
Stem-loop
   guauuaaaaacuaugcucuugggauaacuag          --        guu   a      c                    c   c  a  a 
5'                                uacucccucc  gucccaua   agu ucgcaa uuugucuagauacgcaugua cua ac cu a
                                  ||||||||||  ||||||||   ||| |||||| |||||||||||||||||||| ||| || ||  
3'                                augagggagg  caggguau   uca aguguu aaacagaucuaugcguacau ggu ug ga a
   --------------------------aaaca          gg        aau   c      a                    a   c  c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 22543862-22544027 [-]
intergenic
Database links

Mature sequence bdi-miR5164

Accession MIMAT0020706
Sequence

58 - 

cgcaacuuugucuagauacgc

 - 78

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).