![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR169a |
|
Accession | MI0018120 (change log) |
Description | Brachypodium distachyon miR169a stem-loop |
Gene family | MIPF0000037; MIR169_2 |
Literature search |
![]()
3 open access papers mention bdi-MIR169a |
Stem-loop |
ggaaggguaggauacguuuuugcuugcccgu gcgc u cu ga u c ug aacga c 5' ggcc uaacau agg uggg cua ggug agccaagga acuugccgaucga ugca a |||| |||||| ||| |||| ||| |||| ||||||||| ||||||||||||| |||| a 3' ccgg auugua ucc gucc gau cuac ucgguucuu ugagcggcuagcu acgu u -------------auguaugguggcguacgg ---- c cc uc u a gu ----- a |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence bdi-miR169a-5p |
|
Accession | MIMAT0020695 |
Sequence |
66 - cagccaaggaugacuugccga - 86 |
Evidence | experimental; Illumina [2-3] |
Mature sequence bdi-miR169a-3p |
|
Accession | MIMAT0027068 |
Sequence |
115 - ggcgaguuguucuuggcuaca - 135 |
Evidence | experimental; Illumina [2-3] |
References |
|
1 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
2 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|
3 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|