![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR160d |
|||||
Accession | MI0018106 (change log) | ||||
Description | Brachypodium distachyon miR160d stem-loop | ||||
Gene family | MIPF0000032; MIR160 | ||||
Literature search |
2 open access papers mention bdi-MIR160d | ||||
Stem-loop |
------ -aa u agc uguu c c cu aua --au cu 5' agagacg gg ga uua gggaugugc uggcucc uguaugcca caucu gcaac uc u ||||||| || || ||| ||||||||| ||||||| ||||||||| ||||| ||||| || 3' ucucugc cc cu agu cccuauacg accgagg acgugcggu guagg cguug ag c uacucu caa - --- -ucc a c ag auc gagu uc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR160d-5p |
|
Accession | MIMAT0020681 |
Sequence |
31 - ugccuggcucccuguaugcca - 51 |
Evidence | experimental; Illumina [2] |
Mature sequence bdi-miR160d-3p |
|
Accession | MIMAT0027058 |
Sequence |
100 - gcgugcacggagccaagcaua - 120 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
2 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|