![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR528 |
|||||
Accession | MI0018087 (change log) | ||||
Description | Brachypodium distachyon miR528 stem-loop | ||||
Gene family | MIPF0000868; MIR528 | ||||
Literature search |
2 open access papers mention bdi-MIR528 | ||||
Stem-loop |
-----uuugggguugggauuggg u - cg u g c g u u uu a 5' ggc gg agcagcag guggaaggggca gca aggag ag ga ga gggggg gu c ||| || |||||||| |||||||||||| ||| ||||| || || || |||||| || u 3' ccg cc ucgucguc uaccuucuccgu cgu uccuc uu cu cu cccuuc cg c cgggucgggacggguggcucgug - a cu c g - g - c uu u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR528-5p |
|
Accession | MIMAT0020662 |
Sequence |
36 - uggaaggggcaugcagaggag - 56 |
Evidence | experimental; Illumina [1,3] |
Mature sequence bdi-miR528-3p |
|
Accession | MIMAT0027045 |
Sequence |
102 - ccugugccugccucuuccauu - 122 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:19772667
"Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"
BMC Genomics. 10:449(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|