Stem-loop sequence bdi-MIR5069

AccessionMI0017971 (change log)
DescriptionBrachypodium distachyon miR5069 stem-loop
Stem-loop
   cacuua   c        ug        a         a 
5'       uau uagguuau  auuugacc acaaaauau a
         ||| ||||||||  |||||||| ||||||||| g
3'       gug auucagua  uaaauugg uguuuugug u
   uauauc   u        gu        c         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 5340628-5340708 [-]
intergenic
Database links

Mature sequence bdi-miR5069

Accession MIMAT0020580
Sequence

11 - 

uagguuauugauuugaccaac

 - 31

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).