Stem-loop sequence bdi-MIR5065

AccessionMI0017963 (change log)
DescriptionBrachypodium distachyon miR5065 stem-loop
Stem-loop
   -     aa   u   c    -    uau   -cu     - uu      u  caguguacaagacaaauugaaucgugauuuaaauaugcaguccuau 
5'  ugaaa  ggc agg aauu cacu   aca   augau a  cagaac ag                                              a
    |||||  ||| ||| |||| ||||   |||   ||||| |  |||||| ||                                               
3'  acuuu  ccg ucu uuga guga   ugu   uacua u  guuuug uc                                              a
   u     ga   -   c    u    --u   uuu     c uc      u  cuugcucuuucuugaucucaagaucccacaguuaaaucaggauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 59067940-59068130 [-]
intergenic
Database links

Mature sequence bdi-miR5065

Accession MIMAT0020572
Sequence

11 - 

uaggcaauucacuuauacacu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).