Stem-loop sequence bdi-MIR5064

AccessionMI0017962 (change log)
DescriptionBrachypodium distachyon miR5064 stem-loop
Stem-loop
   ucaac  ca        c    cuu     a -    a   cuuucuccauc    ----c       -  auauccaucaaucagugaauuaaauguaauaacguugggucuuucaccuauauguauaaccaagucaaagauauccugugcauccacaacucuuccuucuuugcauagacuguuuauuauugaa 
5'      gc  gcugaugc augg   caagu c accg aug           uugc     gacuaag cc                                                                                                                            c
        ||  |||||||| ||||   ||||| | |||| |||           ||||     ||||||| ||                                                                                                                             
3'      cg  cgacuacg uacc   guuua g uggu uac           aacg     cugauuu gg                                                                                                                            u
   ccagc  ac        a    --u     a c    c   ----------u    auacc       u  cuugccuuaacaaauagugagggaauaagucgccaaaacauacauaccauuaaaccaauuucgcuuccucaaccaaagacuuuacuacucgucuccguaaggaacaggauuguaacgcaagaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 38751727-38752100 [+]
intergenic
Database links

Mature sequence bdi-miR5064

Accession MIMAT0020571
Sequence

344 - 

cgaauuuguccauagcaucag

 - 364

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).