Stem-loop sequence bdi-MIR5062a

AccessionMI0017959 (change log)
DescriptionBrachypodium distachyon miR5062a stem-loop
Stem-loop
   c     aug           g      -            a       g        u  ---------     uc  a 
5'  guagc   gugaaccuugg gaaaag ccgccuaacaug uuaaauu uauuuugu cu         acuau  ca a
    |||||   ||||||||||| |||||| |||||||||||| ||||||| |||||||| ||         |||||  ||  
3'  uauug   uacuuggaauc cuuuuu ggcggauuguac aauuuga augagacg gg         uggug  gu a
   c     gug           a      a            -       a        u  aauauaaca     uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 24013988-24014136 [-]
intergenic
Database links

Mature sequence bdi-miR5062a

Accession MIMAT0020568
Sequence

11 - 

ugaaccuuggggaaaagccgccu

 - 33

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).