Stem-loop sequence bdi-MIR5061

AccessionMI0017954 (change log)
DescriptionBrachypodium distachyon miR5061 stem-loop
Stem-loop
   aggauacc    a      ga  g    -     g  aucaucgc    c     -     aauc 
5'         ggug ccgagu  ga agag agaua ca        augg gcugg gaagc    a
           |||| ||||||  || |||| ||||| ||        |||| ||||| |||||    c
3'         ccau ggcucg  cu ucuu ucuau gu        uacc uggcc cuuug    a
   auguuaaa    -      uc  g    g     -  --------    -     u     auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 61734973-61735092 [+]
intergenic
Database links

Mature sequence bdi-miR5061

Accession MIMAT0020563
Sequence

90 - 

ucuguucuguccugcucggua

 - 110

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).