Stem-loop sequence bdi-MIR5060

AccessionMI0017953 (change log)
DescriptionBrachypodium distachyon miR5060 stem-loop
Stem-loop
   ggugggcaccga      -g    aa        -    g   ------     aacuggaacugcggcggcaagguaagaucuaugcggcagcagguuuggggguggaagucgccggugagaggagugguuccggcggcggugagagcucccaagu 
5'             ggcggu  cugg  cuggccgg cggu gac      ggcgg                                                                                                       g
               ||||||  ||||  |||||||| |||| |||      |||||                                                                                                       c
3'             ccgcca  gauc  gaucggcc gcca cug      ccguc                                                                                                       a
   -cuucgcuguaa      ga    --        c    a   uaugaa     caaaagcaccucuuauuauuccucucuacgucuuguucuucuagcuuuuaugaaccguccaaaaaguaggcagggcuuuguguugaguugaguauaucuaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 10072906-10073211 [-]
intergenic
Database links

Mature sequence bdi-miR5060

Accession MIMAT0020562
Sequence

277 - 

cggcuagcuagagaccgccaa

 - 297

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).